View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18579_low_16 (Length: 305)
Name: NF18579_low_16
Description: NF18579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18579_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 290
Target Start/End: Complemental strand, 8393962 - 8393684
Alignment:
| Q |
9 |
aaaaaataaggcacgttgattttgatcaccatagtgatcctctgtttcacttccaatccaa-gatagtatctt----tgattaacatggattttgatgat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| | || || || | ||| ||||| |||||||||||||||| |
|
|
| T |
8393962 |
aaaaaataaggcacgttgattttgatcaccatag--------tgtttcacttccaaacaaatgaaagaaacttaacaagattagcatggattttgatgat |
8393871 |
T |
|
| Q |
104 |
catgagaggaaggtatgaaaagagtaggatcaagtttagctctacaaacaggacaaataggttgtttagaaagccatgtatcagcacattccaaatgaaa |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393870 |
catgagaggaaggaatgaaaagagtaggatcaagtttagctctacaaacaggacaaataggttgtttagaaagccatgtatcagcacattccaaatgaaa |
8393771 |
T |
|
| Q |
204 |
agcatggttgcaacctggaatcacacgtgcagattgttcttgagttatgtcgtcgaggcaaacagcgcattcggggccggctgaaag |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393770 |
agcatggttgcaacctggaatcacacgtgcagattgttcttgagttatgtcgtcgaggcaaacagcgcattcggggccggctgaaag |
8393684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University