View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18579_low_27 (Length: 206)
Name: NF18579_low_27
Description: NF18579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18579_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 27511114 - 27511290
Alignment:
| Q |
16 |
atgaacatctttgaccgcttctagccgataaattttaccaggtttccatattggaccttccactgtgaactttgggtttacttgaggaccctttttgaca |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27511114 |
atgaacatctttgaccgcttccagccgataaattttaccaggtttccatattggaccttccactgtgaactttgggtttacctgaggaccctttttgaca |
27511213 |
T |
|
| Q |
116 |
gcaccgaatagttcctcaacccaactctcaagcacatccaaagactctgcattaattttagcatgtcatcaaaatca |
192 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27511214 |
gcaccaaatagttccacaacccaactctcaagcacatccaaagactctgcattaattttagcatgtcatcaaaatca |
27511290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University