View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1857R-Insertion-9 (Length: 131)
Name: NF1857R-Insertion-9
Description: NF1857R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1857R-Insertion-9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 9 - 122
Target Start/End: Original strand, 848916 - 849030
Alignment:
| Q |
9 |
gaaaagattcgtattcactaatgatgataccaaacatcttaagccaggagcgtcgattccgtcgtcgtttgttattagaattcttcctctcttattatta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
848916 |
gaaaagattcgtattcactaatgatgataccaaacctcttaagccaggagcgtcgattccgtcgtcgtttgttattagaattcttcctctcttattatta |
849015 |
T |
 |
| Q |
109 |
-cctcttccatcgat |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
849016 |
ccctcttccatcgat |
849030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University