View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1857_high_11 (Length: 201)
Name: NF1857_high_11
Description: NF1857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1857_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 48698357 - 48698184
Alignment:
| Q |
18 |
gaacttgctctcctataacataactcctacatgttgtatttttgggtgcaaaacatactagnnnnnnn-atccatatagaatttcatataactattaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48698357 |
gaacttgctctcctataacataactcctacatgttgtatttttgggtgcaaaacatactagttttttttatccatatagaatttcatataactattaaga |
48698258 |
T |
|
| Q |
117 |
gaaatagttcatatagtaaataaatgcaataaaatatagattccgattgatgttaacagtactgattcttctca |
190 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48698257 |
gaaaaagttcatatagtaaataaatgcaataaaatatagattccgattgatgttaacagtactgattcttctca |
48698184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University