View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858-Insertion-16 (Length: 410)
Name: NF1858-Insertion-16
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858-Insertion-16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 147 - 406
Target Start/End: Complemental strand, 43071039 - 43070778
Alignment:
| Q |
147 |
tttcttcctatactcaaagcaaccttcaattcttgcacactactagataataacataaaagttgtatgtcttatt-ctataatatttacgtcaacatgac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
43071039 |
tttcttcctatactcaaagcaaccttcaattcttgcacactactagataataacataaaagttgtatgtcttatttctataatatttacatcagcatgac |
43070940 |
T |
|
| Q |
246 |
gaatgaagtt-atctaaccatcgacaaaacggtcagtctgtgttatcaaattttagattcaaggaggacctagctcaaattttggttatctatatccgtg |
344 |
Q |
| |
|
||||||||| || |||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
43070939 |
aaatgaagtttatttaaccatcgataaaacggtcattctgtattatcaaattttagattcaaggaggacctaacttaaattttggttatctatatccgta |
43070840 |
T |
|
| Q |
345 |
agttgttgttgattgttttgttgcatctaatgtaggtgataaacctatttacacaccttttc |
406 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43070839 |
agttgtggttgattgttttgttgcatctaatgtagatgataaacctatttacacaccttttc |
43070778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 43071166 - 43071121
Alignment:
| Q |
7 |
actatttacagttctcaatatctaacaaaatttatataatggttcc |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43071166 |
actatttacagttctcaatctctaacaaaatttatataatggttcc |
43071121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University