View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858-Insertion-22 (Length: 241)
Name: NF1858-Insertion-22
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858-Insertion-22 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 26160305 - 26160072
Alignment:
| Q |
8 |
gtaatttcctttgttgatatatttttaaccgagtgattaaataaatttaatggttgagatttggtgtaattaaatcccaactctatagtgattccacctc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
26160305 |
gtaatttcctttgttgatatatttttaaccgtgtgatcaaataaatttaatggttgagatttggtgtaattagatcccaactctatagtgatcccacctc |
26160206 |
T |
 |
| Q |
108 |
atcagaatctaagaatgcaaattctcaccatcacaatcctattcctacttattctgatcccatctcatttcttatttagtttttactcttggtcacactt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26160205 |
atcagaatctaagaatgcaaattctcaccatcacaatcctattcctacttattctgatcccatctcatttcttatttagtttttactcttggtcaaactt |
26160106 |
T |
 |
| Q |
208 |
gataacatcttggatccaataaacgttgcttaga |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
26160105 |
gataacatcttggatccaataaacgtttcttaga |
26160072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 76
Target Start/End: Original strand, 26160897 - 26160961
Alignment:
| Q |
12 |
tttcctttgttgatatatttttaaccgagtgattaaataaatttaatggttgagatttggtgtaa |
76 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||| ||||||||||||||||| || |||| ||||| |
|
|
| T |
26160897 |
tttcctttgttaatatttttttaaccgtgtgatcaaataaatttaatggttaaggtttgatgtaa |
26160961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 156 - 241
Target Start/End: Complemental strand, 16839894 - 16839809
Alignment:
| Q |
156 |
ttattctgatcccatctcatttcttatttagtttttactcttggtcacacttgataacatcttggatccaataaacgttgcttaga |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
16839894 |
ttattctgatcccatctcaattcttatttagtcgttactcttggtcacacttgataacattttggatccaataaacgtttcttaga |
16839809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University