View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858-Insertion-32 (Length: 69)
Name: NF1858-Insertion-32
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858-Insertion-32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 52049996 - 52049934
Alignment:
| Q |
7 |
aatttcaacttattattacgttcttggtgttttggtttaccaatgaaattgtaggtattggga |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52049996 |
aatttcaacttattattacgttcttggtgttttggtttaccaatgaaattgtaggtattggga |
52049934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University