View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858-Insertion-40 (Length: 185)
Name: NF1858-Insertion-40
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858-Insertion-40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 4e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 7 - 117
Target Start/End: Complemental strand, 2357472 - 2357362
Alignment:
| Q |
7 |
ataaaattctcaactaacaatgctaatatttatgttatgttggacatatctaactgagtttgaatctaaaatcttatggttatgtgtttcgtatgatgtt |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2357472 |
ataaaattctcaactaacaatgttaatatttatgttatgttggacatctctaactgagtttgaatctaaaatcttacggttatgtgtttcgtatgatgtt |
2357373 |
T |
 |
| Q |
107 |
tgccatttctt |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
2357372 |
tgccatttctt |
2357362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University