View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858-Insertion-42 (Length: 153)
Name: NF1858-Insertion-42
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858-Insertion-42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 24696406 - 24696505
Alignment:
| Q |
8 |
ctaataaagttttatgctctcaggtgtgtcaacatgagaaattggttgatct-atgtaagaacttattgcggaataatcaaaactggatcacatataatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24696406 |
ctaataaagttttatgctctcaggtgtgtcaacatgagaaattggttggtctaatgtaagaacttattgcggaataatcaaaactggatcacatataatg |
24696505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University