View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1858-Insertion-44 (Length: 68)
Name: NF1858-Insertion-44
Description: NF1858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1858-Insertion-44 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 1e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 1e-27
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 29549029 - 29549090
Alignment:
| Q |
7 |
agaaggttcctttgattctgttattcaaggatgccatggtgtctttcatactgcttcacccg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29549029 |
agaaggttcctttgattctgttattcaaggatgccatggtgtctttcatactgcttcacccg |
29549090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 29555238 - 29555297
Alignment:
| Q |
7 |
agaaggttcctttgattctgttattcaaggatgccatggtgtctttcatactgcttcacc |
66 |
Q |
| |
|
||||||||| ||||| |||||||||||| || |||||||| |||||||| |||||||| |
|
|
| T |
29555238 |
agaaggttcatttgaccatgttattcaaggttgtcatggtgtttttcataccgcttcacc |
29555297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 87876 - 87929
Alignment:
| Q |
7 |
agaaggttcctttgattctgttattcaaggatgccatggtgtctttcatactgc |
60 |
Q |
| |
|
||||||| |||||||||||||| ||||||| || |||||||||||||| ||||| |
|
|
| T |
87876 |
agaaggtgcctttgattctgttgttcaaggctgtcatggtgtctttcacactgc |
87929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 26101021 - 26101080
Alignment:
| Q |
7 |
agaaggttcctttgattctgttattcaaggatgccatggtgtctttcatactgcttcacc |
66 |
Q |
| |
|
||||||||||||||| |||||| || | || || ||||||||||||||||||||||||| |
|
|
| T |
26101021 |
agaaggttcctttgactctgttgttgagggttgtgatggtgtctttcatactgcttcacc |
26101080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 25933502 - 25933561
Alignment:
| Q |
7 |
agaaggttcctttgattctgttattcaaggatgccatggtgtctttcatactgcttcacc |
66 |
Q |
| |
|
||||||||| ||||| |||||| || | || || ||||||||||||||||||||||||| |
|
|
| T |
25933502 |
agaaggttcttttgactctgttgttgagggttgtgatggtgtctttcatactgcttcacc |
25933561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University