View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_high_20 (Length: 387)
Name: NF18580_high_20
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 8 - 370
Target Start/End: Complemental strand, 35495897 - 35495535
Alignment:
| Q |
8 |
tgtgtagtgtttagtatcaattttgtgttgaatccgagattttgatttgggagtaagaaaactctcttcctcaaacccaaaaccctttctgtttggatgg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35495897 |
tgtgtagtgtttagtatcaattttgtgttgaatccgagattttgatttgtgagtaagaaaactctcttcctcaaacccaaaaccctttccgtttggatgg |
35495798 |
T |
|
| Q |
108 |
atttccaagtagtggttctcgccggtggcgtttccaaaaaactcctccccctcgtttcgcatgagcttcccaacgctttacttccggtcgctaaccgtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35495797 |
atttccaagtagtggttctcgccggtggcgtttccaaaaaactcctccccctcgtttcgcatgagcttcccaacgctttacttccggtcgctaaccgtcc |
35495698 |
T |
|
| Q |
208 |
cgttctctcttacgttgtcgagcttttggagcttagcaatcttaaagatcttatcgtcgtatgctaccattctcatcaatttcactgttttttcaatgaa |
307 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35495697 |
cgttctctcttacgttgtggagcttttggagcttagcaatcttaaagatcttatcgtcgtatgctaccattctcatcaatttcactgttttttcaatgaa |
35495598 |
T |
|
| Q |
308 |
ttagtactgaaatttgtgtgatgatcgtgttgtgtttttctgtaggttgttgaaggtaaagat |
370 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35495597 |
ttagttctgaaatttgtgtgatgatcgtgttgtgtttttctgtaggttgttgaaggtaaagat |
35495535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University