View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_high_34 (Length: 325)
Name: NF18580_high_34
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 38785535 - 38785812
Alignment:
| Q |
16 |
atcacaagtcaaaagaaaaagggtcatatatcatacaaaattgagaagtgcattgtatttgtaccttggttttatcaatagtctgaaagaaatcacccaa |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38785535 |
atcaaaagtcaaaagaaaaagggtcatatatcatataaaattgagaagtgcattgtatttgtaccttggttttatcaataatctgaaagaaatcacccaa |
38785634 |
T |
 |
| Q |
116 |
tgcgataaagtctcttaggcctaactttgtccttcttgatcccaaaattgagatagtgctataaacaagcctccaacacccatccaccttccagtaatag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38785635 |
tgcgataaagtctcttaggcctaactttgtccttcttgatcccaaaattgagatagtgctataaacaagcctccaacacccatccaccttccagtaatag |
38785734 |
T |
 |
| Q |
216 |
aaacataacatgattatgaaagtttgtgtatgacaatcaatatagtttnnnnnnntgtgatttaggcctcgacatcaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38785735 |
aaacataacatgattatgaaagtttgtgtatgacaattaatatagtttaaaaaaatgtgatttaggcctcgacatcaa |
38785812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University