View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_high_65 (Length: 254)
Name: NF18580_high_65
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 5 - 229
Target Start/End: Complemental strand, 38876374 - 38876141
Alignment:
| Q |
5 |
gtcctaagccccttcatctatcatcgcttcattccaatttcagaaccaaactaaagttgccatctttttccatttctagaccaacccatttcaaggtttc |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876374 |
gtcctaagccccttcatctgtcatcgcttcattccaatttcagaaccaaactaaagttgccatctttttccatttctagaccaacccatttcaaggtttc |
38876275 |
T |
 |
| Q |
105 |
acaaaattcaa---------ctgaagaatcactctctaatgacttgctcattgtgggtcccggtgttcttggtcgcttggtagctcaaaaatggcgacat |
195 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876274 |
acaaaattcaatcacaaccactgaagaatcactctctaatgacttgctcattgtgggtcccggtgttcttggtcgcttggtagctcaaaaatggcgacat |
38876175 |
T |
 |
| Q |
196 |
gtacgtactcttttcatcttctttcttttattgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38876174 |
gtacgtactcttttcatcttctttcttttattgt |
38876141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University