View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_high_71 (Length: 250)
Name: NF18580_high_71
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_high_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 11 - 178
Target Start/End: Complemental strand, 40750970 - 40750803
Alignment:
| Q |
11 |
taatactagtaatggtggtactttttgttctgctatcaacaccaaggtttgaccatgactgggattttcaccgatggtcaacaataaagagnnnnnnnat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
40750970 |
taatactagtaatggtggtactttttgttctgctatcaacaccaaggtttgaccatgactcggattttcaccgatggtcaacaataaagagtttttttat |
40750871 |
T |
 |
| Q |
111 |
ttaaaaaggagcaataaatagtttattctatcctttgaaaaaatagattacctattaaattataactt |
178 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40750870 |
ttgaaaaggagcaataaatagtttattctatcctttgaaaaaatagattacctattaaattataactt |
40750803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 191 - 250
Target Start/End: Complemental strand, 40750716 - 40750657
Alignment:
| Q |
191 |
tgtttcaagtaagagaagccaaaaacgataacaacgttaagacagaacaacaaaaccaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40750716 |
tgtttcaagtaagagaagccaaaaacgataacaacgttaagacagaacaacaaaaccaac |
40750657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University