View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_high_72 (Length: 248)
Name: NF18580_high_72
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_high_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 123 - 240
Target Start/End: Complemental strand, 49975070 - 49974953
Alignment:
| Q |
123 |
gcggcgacaaagaaaagtgaaaaaatttagttgttggtggtgcgtcattagtactataattggtttttatgttttaggaagataaatatgatatcaaaat |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49975070 |
gcggagacaaagaaaagtgaaaaaatttagttgttggtggtgcgtcattagtactataattggtttttatgttttaggaagataaatatgataacaaaat |
49974971 |
T |
 |
| Q |
223 |
tttgagttatagaataat |
240 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
49974970 |
ttcgagttatagaataat |
49974953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 23977570 - 23977635
Alignment:
| Q |
177 |
tataattggttttt-atgttttaggaagataaatatgatatcaaaattttgagttatagaataatc |
241 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
23977570 |
tataattggttttttatcttttaggaagataaatacgataacaaaattttgagttttagaataatc |
23977635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University