View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18580_high_77 (Length: 237)

Name: NF18580_high_77
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18580_high_77
NF18580_high_77
[»] chr1 (1 HSPs)
chr1 (79-214)||(15970856-15970991)


Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 79 - 214
Target Start/End: Complemental strand, 15970991 - 15970856
Alignment:
79 tacttggaaaacaaattaaagctaacagcaagtaatgtcaaacttttttaataaaaataagaaaaatattagttacattgttattactaaattatgttag 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
15970991 tacttggaaaacaaattaaagctaacagcaagtaatgtcaaacttttttaataaaaataagaaaaatattagttacattgtcattactaaattatgttag 15970892  T
179 tactagatattaaacccttaacttgcttctcaaact 214  Q
    ||||||||||||||||||||||||||||||||||||    
15970891 tactagatattaaacccttaacttgcttctcaaact 15970856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University