View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18580_high_80 (Length: 235)

Name: NF18580_high_80
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18580_high_80
NF18580_high_80
[»] scaffold0716 (1 HSPs)
scaffold0716 (23-223)||(6440-6640)
[»] chr1 (1 HSPs)
chr1 (23-126)||(36161780-36161883)
[»] chr8 (2 HSPs)
chr8 (123-201)||(29172431-29172509)
chr8 (52-126)||(29172337-29172411)


Alignment Details
Target: scaffold0716 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0716
Description:

Target: scaffold0716; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 23 - 223
Target Start/End: Original strand, 6440 - 6640
Alignment:
23 atgttttgtagtgttgtttctctcagaggttttttgagactaaattgcagcaacaaggtgtcggtttctcacatgttttgtacgcttggaagaataaata 122  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||     
6440 atgttttgtagtggtgtttctctcagaggttttttgagactaaattgcagcaacaaggtgtcggtttctcacatgttttgtacgcttggaagaatgaatt 6539  T
123 gagtactaacttaattgttaatgagttgtgaagttgtgattgatttatcaaggatgtaattgaattacacttcattaaagacaagaacttttgtttatat 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||    
6540 gagtactaacttaattgttaatgagttgtgaagttgtgattgatttatcaaggatgtaattgaattacactttattaaagacaagaacttttgtttgtat 6639  T
223 t 223  Q
    |    
6640 t 6640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 23 - 126
Target Start/End: Complemental strand, 36161883 - 36161780
Alignment:
23 atgttttgtagtgttgtttctctcagaggttttttgagactaaattgcagcaacaaggtgtcggtttctcacatgttttgtacgcttggaagaataaata 122  Q
    |||||||| |||| | ||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| ||||||| |||||||||||| ||||    
36161883 atgttttgcagtggtctttctctcagaggttttctgagaccaaattgcagcaacaaggtgttggtttctcacatattttgtatgcttggaagaatgaata 36161784  T
123 gagt 126  Q
    ||||    
36161783 gagt 36161780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 201
Target Start/End: Original strand, 29172431 - 29172509
Alignment:
123 gagtactaacttaattgttaatgagttgtgaagttgtgattgatttatcaaggatgtaattgaattacacttcattaaa 201  Q
    |||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||  |||||||||||||| ||||||    
29172431 gagtactaacataattgttaatgagttatgaagttgtgattgatttatcaaggttgcgattgaattacactttattaaa 29172509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 52 - 126
Target Start/End: Original strand, 29172337 - 29172411
Alignment:
52 ttttttgagactaaattgcagcaacaaggtgtcggtttctcacatgttttgtacgcttggaagaataaatagagt 126  Q
    |||||| |||| |||||| ||||||||||||| ||||||| |||||||||||| | |||||||||| ||||||||    
29172337 tttttttagaccaaattgtagcaacaaggtgttggtttcttacatgttttgtatgtttggaagaatgaatagagt 29172411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University