View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_high_84 (Length: 221)
Name: NF18580_high_84
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 17738561 - 17738359
Alignment:
| Q |
1 |
aaacttgataggtaatggagagagagaggggtttctgtattctgcatatatgctttctctactttgtaactcttttgcttctggctgtctttggtttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17738561 |
aaacttgataggtaatggagagagagaggggtttctgcattctgcatatatgctttctctactttgtaactgttttgcttctggctgtctttggtttgtt |
17738462 |
T |
 |
| Q |
101 |
tgtttcatttttagacaagttaatttgctatgattagcataaaaccaaacttaaccgataaacctaaccatactaacaaagattgaattgtgacaaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
17738461 |
tgtttcatttttagacaagttaatttactatgattagcataaaaccaaacttaaccgataaacctaaccataccaacaaagactgaattgtgacaaaaat |
17738362 |
T |
 |
| Q |
201 |
ttc |
203 |
Q |
| |
|
||| |
|
|
| T |
17738361 |
ttc |
17738359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University