View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_38 (Length: 312)
Name: NF18580_low_38
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 53 - 304
Target Start/End: Original strand, 5232064 - 5232310
Alignment:
| Q |
53 |
ataaagcagagcagttaccgtgaatacttgaagctgaaacaaagatttgaaaatcttcaaagagcacagaggtaaagaattttacattaaattttcatat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
5232064 |
ataaagcagagcagttaccgtgaatacttgaagctgaaacaaagatttgaaaatcttcaaagagcacagaggtaaagatttttacattaa-ttttcatat |
5232162 |
T |
|
| Q |
153 |
tttctatagtgaaatatttgccaatatatcgacactattaattgtgtgtgtatgtatgtgtctccaatatttcagaaatcttttaggtgaagatttgggt |
252 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5232163 |
tttttatagtgaaatatttgccaatatatcgacactattaattgtgtgtgta----tgtgtctccaatatttcagaaatcttttaggtgaagatttgggt |
5232258 |
T |
|
| Q |
253 |
ccactaagttctaaggatcttgagcagcttgaaaggcaattggattcatctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5232259 |
ccactaagttctaaggatcttgagcagcttgaaaggcaattggattcatctc |
5232310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 57 - 114
Target Start/End: Original strand, 5655796 - 5655853
Alignment:
| Q |
57 |
agcagagcagttaccgtgaatacttgaagctgaaacaaagatttgaaaatcttcaaag |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
5655796 |
agcagagcagttaccgtgagtacttgaagctgaaagcaagatttgaatctcttcaaag |
5655853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University