View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_63 (Length: 264)
Name: NF18580_low_63
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 259
Target Start/End: Complemental strand, 33397592 - 33397342
Alignment:
| Q |
9 |
tcaagttcatgaaatcaacccttcttctaagggaaccacttgaacatgttttggagcaagaaaaaccagattgtttagttgctgacatgtttttcccttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397592 |
tcaagttcatgaaatcaacccttcttctaagggaaccacttgaacatgttttggaacaagaaaaaccagattgtttagttgctgacatgtttttcccttg |
33397493 |
T |
 |
| Q |
109 |
gtcaactgattctgcagcaaaattcaacattcctaggattgtgtttcatggtttagggttctttcctctatgtgttttggcttgtacaagacagtacaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33397492 |
gtcaactgattctgcagcaaaattcaacattcctaggattgtgtttcatggtttaggtttcttccctttatgtgttttggcttgtacaagacagtacaaa |
33397393 |
T |
 |
| Q |
209 |
ccacaagataaagtctcatcttacacagaaccttttgttgttcctaatctt |
259 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397392 |
cctcaagataaagtctcatcttacacagaaccttttgttgttcctaatctt |
33397342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University