View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18580_low_64 (Length: 261)

Name: NF18580_low_64
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18580_low_64
NF18580_low_64
[»] chr1 (1 HSPs)
chr1 (103-245)||(26799110-26799243)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 103 - 245
Target Start/End: Original strand, 26799110 - 26799243
Alignment:
103 taaatgtcctattgccgatttaatcattaatccataacgatcttgaatagtctaaattgtgggaataccttaggatggacgaaagattttaatttcaatg 202  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||| |||||    
26799110 taaatgtcctattgacgatttaatcattaatccataacgatcttgaatagtctaaattgtgggaata---------ggacgaaagattttaattgcaatg 26799200  T
203 ggttaaaaaagaaaagttttgtatagcataccttgattgttgg 245  Q
    ||||||||||||||||||||||||||||||||||||| |||||    
26799201 ggttaaaaaagaaaagttttgtatagcataccttgatggttgg 26799243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University