View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_64 (Length: 261)
Name: NF18580_low_64
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 103 - 245
Target Start/End: Original strand, 26799110 - 26799243
Alignment:
| Q |
103 |
taaatgtcctattgccgatttaatcattaatccataacgatcttgaatagtctaaattgtgggaataccttaggatggacgaaagattttaatttcaatg |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26799110 |
taaatgtcctattgacgatttaatcattaatccataacgatcttgaatagtctaaattgtgggaata---------ggacgaaagattttaattgcaatg |
26799200 |
T |
 |
| Q |
203 |
ggttaaaaaagaaaagttttgtatagcataccttgattgttgg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26799201 |
ggttaaaaaagaaaagttttgtatagcataccttgatggttgg |
26799243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University