View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_71 (Length: 250)
Name: NF18580_low_71
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 232
Target Start/End: Complemental strand, 5231939 - 5231709
Alignment:
| Q |
2 |
acaacgtattccgaccttattcgatacagtttctgattttatattaattttttctctcttctaagaatccgaatgcactaaaatgagtgtattttatacg |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5231939 |
acaacgtattctgaccttattcgatacagtttctgattctatattaattttttctctcttctaagaatccgaatgcactaaaatgagtgtattttatacg |
5231840 |
T |
 |
| Q |
102 |
gtgttgggtatacaatgtcagatatgtattcaaaaatcagtgttgattataaatggtagcaaaacctacctcaagttctttagcaggtttgctaacttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5231839 |
gtgttgggtatacaatgtcagatatgtgttcaaaaatcagtgttgattataaatggaagcgatacctacctcaagttctttagcaggtttgctaacttct |
5231740 |
T |
 |
| Q |
202 |
acagcaccataactgcacttctggtacctat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5231739 |
acagcaccataactgcacttctggtacctat |
5231709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University