View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18580_low_77 (Length: 238)

Name: NF18580_low_77
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18580_low_77
NF18580_low_77
[»] chr7 (3 HSPs)
chr7 (73-193)||(3128390-3128510)
chr7 (73-155)||(2987807-2987889)
chr7 (73-143)||(3291535-3291605)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 73 - 193
Target Start/End: Original strand, 3128390 - 3128510
Alignment:
73 aacattgccttttacataaaaaactaggaaaacataagaaccaaaactcgtgaaaaagcttatagtgtccattgtagaatgcagatagtcttttttctta 172  Q
    |||||||||||||| |||  |||||| ||||||||||||  |||||||| || ||||||||| |||||||| | |||||||| ||||| ||| |||||||    
3128390 aacattgccttttaaatagtaaactaagaaaacataagaggcaaaactcatggaaaagcttacagtgtccaatatagaatgccgatagccttgtttctta 3128489  T
173 ctctcatttgaacaaacattt 193  Q
    |||||||||||||||| ||||    
3128490 ctctcatttgaacaaatattt 3128510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 73 - 155
Target Start/End: Complemental strand, 2987889 - 2987807
Alignment:
73 aacattgccttttacataaaaaactaggaaaacataagaaccaaaactcgtgaaaaagcttatagtgtccattgtagaatgca 155  Q
    |||||| ||||||||||| ||||||| ||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||    
2987889 aacatttccttttacatagaaaactatgaaaacataagaagcaaaactcgtgaaaaggcttatagtgtccactgtagaatgca 2987807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 73 - 143
Target Start/End: Complemental strand, 3291605 - 3291535
Alignment:
73 aacattgccttttacataaaaaactaggaaaacataagaaccaaaactcgtgaaaaagcttatagtgtcca 143  Q
    |||||||||||||||||| |||||||| |||||||||||| |||||||| ||||||||||||  |||||||    
3291605 aacattgccttttacatagaaaactagaaaaacataagaagcaaaactcatgaaaaagcttacggtgtcca 3291535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University