View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_78 (Length: 237)
Name: NF18580_low_78
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_78 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 79 - 214
Target Start/End: Complemental strand, 15970991 - 15970856
Alignment:
| Q |
79 |
tacttggaaaacaaattaaagctaacagcaagtaatgtcaaacttttttaataaaaataagaaaaatattagttacattgttattactaaattatgttag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15970991 |
tacttggaaaacaaattaaagctaacagcaagtaatgtcaaacttttttaataaaaataagaaaaatattagttacattgtcattactaaattatgttag |
15970892 |
T |
|
| Q |
179 |
tactagatattaaacccttaacttgcttctcaaact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15970891 |
tactagatattaaacccttaacttgcttctcaaact |
15970856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University