View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_82 (Length: 235)
Name: NF18580_low_82
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 48674610 - 48674802
Alignment:
| Q |
18 |
tatatacagtctagttttctgctccctgaattgccttgaacaccgtcgcatcaatcgaggcttttctattctcattgataatgattgtctactcttgcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674610 |
tatatacagtctagttttctgctccctgaattgccttgaacaccgtcgcatcaatcgaggcttttctattctcattgataatgattgtctactcttgcta |
48674709 |
T |
 |
| Q |
118 |
tatatagatatgatattatagctataactcttatagtataaaacacgtacaagaacttatgattatatatagaagaagaagaaggtagtgatgaattatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48674710 |
tatatagatatgatattatagctataactcttatagtataaaac----acaagaacttatgattatatat---agaagaagaaggtagtgatgaattatg |
48674802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University