View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18580_low_84 (Length: 222)

Name: NF18580_low_84
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18580_low_84
NF18580_low_84
[»] chr1 (1 HSPs)
chr1 (14-205)||(32286566-32286757)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 32286566 - 32286757
Alignment:
14 agatgaagatagaattcggtgctcgagagattgaatttgaagtttaagttcagaaatctctctgagaagctcagcccgttcacggttccatcgattctcc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32286566 agatgaagatagaattcggtgctcgagagattgaatttgaagtttaagttcagaaatctctctgagaagctcagcccgttcacggttccatcgattctcc 32286665  T
114 tcacgaatccaccgttgctcctcgcgaagccatcgttgttcttcgcggagccagcggtgttcttcacgatcgggaatggagcagtgagtggt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32286666 tcacgaatccaccgttgctcctcgcgaagccatcgttgttcttcgcggagccagcggtgttcttcacgatcgggaatggagcagtgagtggt 32286757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University