View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18580_low_85 (Length: 221)

Name: NF18580_low_85
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18580_low_85
NF18580_low_85
[»] chr5 (1 HSPs)
chr5 (1-203)||(17738359-17738561)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 17738561 - 17738359
Alignment:
1 aaacttgataggtaatggagagagagaggggtttctgtattctgcatatatgctttctctactttgtaactcttttgcttctggctgtctttggtttgtt 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
17738561 aaacttgataggtaatggagagagagaggggtttctgcattctgcatatatgctttctctactttgtaactgttttgcttctggctgtctttggtttgtt 17738462  T
101 tgtttcatttttagacaagttaatttgctatgattagcataaaaccaaacttaaccgataaacctaaccatactaacaaagattgaattgtgacaaaaat 200  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||    
17738461 tgtttcatttttagacaagttaatttactatgattagcataaaaccaaacttaaccgataaacctaaccataccaacaaagactgaattgtgacaaaaat 17738362  T
201 ttc 203  Q
    |||    
17738361 ttc 17738359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University