View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18580_low_87 (Length: 212)
Name: NF18580_low_87
Description: NF18580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18580_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 23428025 - 23428126
Alignment:
| Q |
1 |
catgcaacacttggtttttagttaaatctatagcatattgttatcaacgagcaacgcagtaagcttgcaaacttctatcttcagttctcttaacacataa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23428025 |
catgcaacacttggtttttagctaaatctatagcatattgttatcaacgagcaacgcagtaagcttgcaaacttctatcttcagttctcttaacacataa |
23428124 |
T |
|
| Q |
101 |
tc |
102 |
Q |
| |
|
|| |
|
|
| T |
23428125 |
tc |
23428126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University