View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_high_32 (Length: 271)
Name: NF18583_high_32
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 2265261 - 2265444
Alignment:
| Q |
14 |
aaaataatattttgtccaccaaacatagatcatacaacataaaaagttgctcaatactttaaaggtttgtcatatgttgttttgtatgatattattgtgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265261 |
aaaataatattttgtccaccaaacatagatcatacaacataaaaagttgctcaatactttaaaggtttgtcatatgttgttttgtatgatattattgtgt |
2265360 |
T |
|
| Q |
114 |
cccgtatttac-ttttagtatatcaaacacacctttttccttcacgggtttctaattagttctaataacttggtcttttggtat |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
2265361 |
tccgtatttactttttagtatatcaaacacacctttttccttcacgggtttctaattagttctaataacttgatcttttagtat |
2265444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University