View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_high_38 (Length: 249)
Name: NF18583_high_38
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_high_38 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 29287183 - 29287416
Alignment:
| Q |
16 |
cagttatcaggctgacagtgcagttgtgcatgctttctggcttttatgcggtttctgtctgttttctggtgctggtgtgacagactggcagtttgctggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287183 |
cagttatcaggctgacagtgcagttgtgcatgctttctggcttttatgcggtttctgtctgttttctggtgctggtgtgacagactggcagtttgctggt |
29287282 |
T |
 |
| Q |
116 |
gcaagctgttatgtgcccgattttaccacccatataaactatgtcagcacaccacaccaccgtacacctaatctaaactcttttaaataaaaacaatgga |
215 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29287283 |
gcaagctgttatgtgcctgattttgccacccatataaactatgttagcacgccacaccaccgtacacctaatctaaattcttttaaataaaaacaatgga |
29287382 |
T |
 |
| Q |
216 |
tgttcactaaatcgattattacaattttgaagac |
249 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
29287383 |
tgttcactaaatcaattattacaattttgaagac |
29287416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University