View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_high_7 (Length: 460)
Name: NF18583_high_7
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 2e-84; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 14886149 - 14885983
Alignment:
| Q |
19 |
ctctatgtgtcatctaaagtatgaagatcacacctttctcattagtgatgcatttatggctaacgtttgtgattcttatgattcatgatcaagatgattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14886149 |
ctctatgtgtcatctaaagtatgaagatgacacctttctcattagtgatgcatttatggctaacgtttgtgattcttgtgattcatgatcaagatgattc |
14886050 |
T |
 |
| Q |
119 |
cctaaggctagctaagaagtttctccattgtagtatagggacaaatcctttctagtacctgagcttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14886049 |
cctaaggctagctaagaagtttctccattgtagtatagggacaaatcctttctagtacctgagcttt |
14885983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 329 - 454
Target Start/End: Complemental strand, 14885975 - 14885850
Alignment:
| Q |
329 |
ctttgtattattgagtgattttagaggccttaatgcgagcactttaatttcaaacatatcatgggacctgggatagaattttctcaactagtaatgtctt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14885975 |
ctttgtattattgagtgattttagaggccttaatgcgagcactttaatttcaaacatatcatgggacctgggatagaattttctcaaatagtaatgtctt |
14885876 |
T |
 |
| Q |
429 |
cagaggccttttgaatcttcatttca |
454 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14885875 |
cagaggccttttgaatcttcatttca |
14885850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 454
Target Start/End: Complemental strand, 17352170 - 17352129
Alignment:
| Q |
413 |
caactagtaatgtcttcagaggccttttgaatcttcatttca |
454 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
17352170 |
caacttgtaatgtcttcaaaggcctcttgaatcttcatttca |
17352129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 390 - 451
Target Start/End: Original strand, 24320389 - 24320450
Alignment:
| Q |
390 |
tgggacctgggatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcatt |
451 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||| | | | ||||||||||||| |
|
|
| T |
24320389 |
tgggacttgggatagaattttcccaacttctaatgtcttcagtgacatcttgaatcttcatt |
24320450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 400 - 451
Target Start/End: Original strand, 16714440 - 16714491
Alignment:
| Q |
400 |
gatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcatt |
451 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
16714440 |
gataaaatttcctcaacttgtaatgtcttcagaggcctcttgaatcttcatt |
16714491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 403 - 454
Target Start/End: Complemental strand, 25987285 - 25987234
Alignment:
| Q |
403 |
agaattttctcaactagtaatgtcttcagaggccttttgaatcttcatttca |
454 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
25987285 |
agaatttcctcaacttgtaatgtctccagagacctcttgaatcttcatttca |
25987234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 397 - 451
Target Start/End: Original strand, 12865001 - 12865055
Alignment:
| Q |
397 |
tgggatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcatt |
451 |
Q |
| |
|
||||||| ||||| ||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
12865001 |
tgggataaaatttcctcaacttgtaatgtcttcagagacctcttgaatcttcatt |
12865055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 397 - 451
Target Start/End: Complemental strand, 29985471 - 29985417
Alignment:
| Q |
397 |
tgggatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcatt |
451 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29985471 |
tgggatagaatttttccaacttgtaatgtcttcagagacctcttgaatcttcatt |
29985417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 405 - 451
Target Start/End: Complemental strand, 20103190 - 20103144
Alignment:
| Q |
405 |
aattttctcaactagtaatgtcttcagaggccttttgaatcttcatt |
451 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||| ||||| |
|
|
| T |
20103190 |
aattttctcaacttgtaatgtcatcagaggcctcttgaatcctcatt |
20103144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University