View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_low_26 (Length: 337)
Name: NF18583_low_26
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 17 - 318
Target Start/End: Original strand, 325283 - 325596
Alignment:
| Q |
17 |
tatcaactttacgaagagattggtcaaggcgttagtgcttccgttcatcgcgctctctgtgtttctttcaatgaaatcgtcgccatcaaaattctcgact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
325283 |
tatcaactttacgaagagattggtcaaggcgttagtgcttccgttcatcgcgctctctgtgtttctttcaatgaaatcgtcgccatcaaaattctcgact |
325382 |
T |
 |
| Q |
117 |
tcgaacgcgacaactgcgatctggtaccttattttttcattcatattaatattttaattctaaattgctttcgcc------------acgctgcaaactt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
325383 |
tcgaacgcgacaactgcgatctggtaccttattttttcattcatattaatattttaattctaaattgctttcgccacggttttagttacgctgcaaactt |
325482 |
T |
 |
| Q |
205 |
ctacattgcctatgcatcgtgattttaaattgcgattgcagtcgatgcagtctcatgtgtttgtgaaaatctctaaaacctttattttatggtcataatt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
325483 |
ctacattgcctatgcatcgtgattttaaattgcgattgcagtcgatgctgtctcatgtgtttgtgaaaatctctaaaacctttattttatggtcataatt |
325582 |
T |
 |
| Q |
305 |
gccgttgcagaaca |
318 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
325583 |
gccgttgcagaaca |
325596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University