View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_low_37 (Length: 267)
Name: NF18583_low_37
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 12 - 136
Target Start/End: Complemental strand, 30019498 - 30019373
Alignment:
| Q |
12 |
tcatcagaaataagactagttcaacacttatattgtacttcttttcagttaaagaattacatt-cacttgcttggatgtgtttttctctttgcaaagaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019498 |
tcatcagaaataagactagttcaacacttatattgtacttcttttcagttgaagaattacatttcacttgcttggatgtgtttttctctttgcaaagaac |
30019399 |
T |
 |
| Q |
111 |
atgacaacctttgaaggaaacaatga |
136 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30019398 |
atgacaacctttgaaggaaacaatga |
30019373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 199
Target Start/End: Complemental strand, 30019349 - 30019310
Alignment:
| Q |
160 |
catctgaagctggtccagcttcaacattattattattatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019349 |
catctgaagctggtccagcttcaacattattattattatc |
30019310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University