View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_low_48 (Length: 229)
Name: NF18583_low_48
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 33 - 212
Target Start/End: Complemental strand, 28485186 - 28485007
Alignment:
| Q |
33 |
gaaggagaccctggtaattcggagtttagctgggaggtaagtaaagtctgtctgatcaacattcagctgatcgaccatggatctattgctctaataaaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485186 |
gaaggagaccctggtaattcggagtttagctgggaggtaagtaaagtctgtctgatcaacattcagctgatcgaccatggatctattgctctaataaaaa |
28485087 |
T |
|
| Q |
133 |
atactcaataactatatagtttccagatagaatttcttaccaatttgaagaaaagatgtccacaaagaaccaccaaacaa |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485086 |
atactcaataactatatagtttcctgatagaatttcttaccaatttgaagaaaagatgtccacaaagaaccaccaaacaa |
28485007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University