View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18583_low_51 (Length: 207)
Name: NF18583_low_51
Description: NF18583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18583_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 1769366 - 1769539
Alignment:
| Q |
19 |
aggtatgtgagatttgttaggtttttaagggatactggaatggttcctgtgagaaaattgttacctagttttaactgagttactttagtcaatgcagata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1769366 |
aggtatgtgagatttgttaggtttttaagggatactggaatggttcctgtgagaaaattgttacctagttttaactgagttaatttagtcaatgcagata |
1769465 |
T |
 |
| Q |
119 |
ttgaactaggaattggtcctgtgaatttgtttccttgtagactaaatgcttctaattggttcatgttgcctatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1769466 |
ttgaactaggaattggtcctgtgaatttgttttcttgtagactaaatgcttctaattggttcatgctgcctatg |
1769539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University