View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18584_high_16 (Length: 233)
Name: NF18584_high_16
Description: NF18584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18584_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 81 - 214
Target Start/End: Original strand, 8807743 - 8807876
Alignment:
| Q |
81 |
tttcatgaggacaacaacattaaacattgctagtagcagtggcagtgacagtgctagtgaaagaacttgttgagtttaggtgttaaagaaaaaacaatgc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807743 |
tttcatgaggacaacaacattaaacattgctagtagcagtggcagggacagtgctagtgaaagaacttgttgagtttaggtgttaaagaaaaaacaatgc |
8807842 |
T |
 |
| Q |
181 |
gttcatgacactcccttttattgcataataatgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8807843 |
gttcatgacactcccttttattgcataataatgg |
8807876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University