View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18584_low_25 (Length: 209)

Name: NF18584_low_25
Description: NF18584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18584_low_25
NF18584_low_25
[»] chr5 (1 HSPs)
chr5 (16-195)||(14788328-14788507)


Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 14788507 - 14788328
Alignment:
16 atttcctcgttgatttggttatatgaatctattcaaattccgtttctactattttccgatttgttcatatacatttgtgatttcaatttgcaattgcagt 115  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14788507 atttcctcgttgatttggttatatgaatctgttcaaattccgtttctactattttccgatttgttcatatacatttgtgatttcaatttgcaattgcagt 14788408  T
116 taatttcttcagcatatcagcgatgccgattatcggagcagatttgcagactctcagttattctcactcgctcttcatct 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14788407 taatttcttcagcatatcagcgatgccgattatcggagcagatttgcagactctcagttattctcactcgctcttcatct 14788328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University