View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18585_high_11 (Length: 205)

Name: NF18585_high_11
Description: NF18585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18585_high_11
NF18585_high_11
[»] chr2 (1 HSPs)
chr2 (25-196)||(4258094-4258260)


Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 25 - 196
Target Start/End: Original strand, 4258094 - 4258260
Alignment:
25 cttctctaacaacaatgccatacttccgcttcgactcatcttgtgcagactgagatcgctctcttgctgcagccaaccttgtttcagcaacactgccaca 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4258094 cttctctaacaacaatgccatacttccgcttcgactcatcttgtgcagactgagatcgctctcttgctgcagccaaccttgtttcagcaacactgccaca 4258193  T
125 gctatttcagaactaggcgtgccttctttagttttctcttctgccttgatgaaacttgttcatatattcttc 196  Q
    ||||||||||||||||  |||||||||||||||     ||||||||||||||||||||||||||| ||||||    
4258194 gctatttcagaactagcagtgccttctttagtt-----ttctgccttgatgaaacttgttcatattttcttc 4258260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University