View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18585_high_11 (Length: 205)
Name: NF18585_high_11
Description: NF18585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18585_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 25 - 196
Target Start/End: Original strand, 4258094 - 4258260
Alignment:
| Q |
25 |
cttctctaacaacaatgccatacttccgcttcgactcatcttgtgcagactgagatcgctctcttgctgcagccaaccttgtttcagcaacactgccaca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4258094 |
cttctctaacaacaatgccatacttccgcttcgactcatcttgtgcagactgagatcgctctcttgctgcagccaaccttgtttcagcaacactgccaca |
4258193 |
T |
|
| Q |
125 |
gctatttcagaactaggcgtgccttctttagttttctcttctgccttgatgaaacttgttcatatattcttc |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4258194 |
gctatttcagaactagcagtgccttctttagtt-----ttctgccttgatgaaacttgttcatattttcttc |
4258260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University