View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18585_high_4 (Length: 257)
Name: NF18585_high_4
Description: NF18585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18585_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 13237394 - 13237163
Alignment:
| Q |
19 |
atatggtggtcaatatggtaaaatctgcaaccaagatatattagttatgtcaaatttcattattgtgaagaattttatcacatactggttaaatgtccaa |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
13237394 |
atatggtggtcaatttggtaaaatctgcaaccaagatatattagtattgtcaaatttcattattgtgaagaattttatcacataccggtaaaatgtccaa |
13237295 |
T |
|
| Q |
119 |
aattcatcgagtctttgtgagaaaagtagaatagtgctccttttgaaaatgtggttacttatgatgatgatatagtttttgtaaggataaagctgataac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13237294 |
aattcatcgagtctttgtgagaaaagtagaatagtgctccttttgaaaatgtggttacttatgatgatgatatagtttttgtaaggataaagccgataac |
13237195 |
T |
|
| Q |
219 |
aaaataaagaaaggtgagactttgaacgaatg |
250 |
Q |
| |
|
||| |||||||| |||| |||||||||||||| |
|
|
| T |
13237194 |
aaagtaaagaaatgtgaaactttgaacgaatg |
13237163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University