View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18585_low_5 (Length: 258)
Name: NF18585_low_5
Description: NF18585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18585_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 113 - 249
Target Start/End: Complemental strand, 22080583 - 22080447
Alignment:
| Q |
113 |
gtgaacaacatttcaatagatcggttttccttcttgcattaaatcaatttttcgaactaaaattgtttcagaagtcattttaatcaaagacatatcaaag |
212 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |
|
|
| T |
22080583 |
gtgaacaacacttaaatagatcggttttccttcttgcattaaatcagtttttcgaactaaaattgtttgagaagtcattttaatgaaagacgtatcaaag |
22080484 |
T |
 |
| Q |
213 |
atctattgaactgcatttctattttgtttttgatgat |
249 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
22080483 |
atctattgaactgcatttctgttttgtatttgatgat |
22080447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University