View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18586_high_16 (Length: 330)
Name: NF18586_high_16
Description: NF18586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18586_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 14 - 132
Target Start/End: Complemental strand, 30440830 - 30440712
Alignment:
| Q |
14 |
aggggtagataaagggacctgggtgtctattatagcgcacccagacaaaggttttttcctctctttcgctctaactataaattttggaaaaagagtttat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30440830 |
aggggtagataaagggacctgggtgtctatcacagcgcacccagacaaaggttttttcctctctttcgctctaactataaatcttggaaaaagagtttat |
30440731 |
T |
|
| Q |
114 |
ttcgcgtatgaggttgtcc |
132 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30440730 |
ttcgcgtatgaggttgtcc |
30440712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 182 - 315
Target Start/End: Complemental strand, 30440710 - 30440582
Alignment:
| Q |
182 |
ttttattggaacgatgagctcgcatctatgataggatatgtcttcgctctgcttttgaagtatgaaaaagctgttgtcgctttgttagatcaaatggcag |
281 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30440710 |
ttttattggaacgatgagctcgcatccatgataggatatgacttcgctctgcttttgaagtatgaaaaagctgctgtcgctttgttagatcaaatggcag |
30440611 |
T |
|
| Q |
282 |
aattcactattaaagatctcctagatagagaaat |
315 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30440610 |
-----actattaaagatctcctagatagagaaat |
30440582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University