View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18586_high_26 (Length: 214)

Name: NF18586_high_26
Description: NF18586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18586_high_26
NF18586_high_26
[»] chr4 (1 HSPs)
chr4 (26-200)||(8679473-8679647)
[»] chr3 (1 HSPs)
chr3 (28-200)||(37740268-37740446)


Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 26 - 200
Target Start/End: Complemental strand, 8679647 - 8679473
Alignment:
26 cttgcagtggattttgcatgattggggggatgaagaatgcatccaaatattgaagaaatgtaaggaagctattccaaatgacaatggaagagtaattatc 125  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8679647 cttgcagcggattttgcatgattggggggatgaagaatgcatccaaatattgaagaaatgtaaggaagctattccaaatgacaatggaagagtaattatc 8679548  T
126 gtggaagcagtgattgaagaaggaggaaaccacaagtataaagatgtagggttagtcttagatacggtgatgatg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||    
8679547 gtggaagcagtgattgaagaaggaggaaaccacaagtataaagatgtagggttagtgttagacatggtgatgatg 8679473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 28 - 200
Target Start/End: Complemental strand, 37740446 - 37740268
Alignment:
28 tgcagtggattttgcatgattggggggatgaagaatgcatccaaatattgaagaaatgtaaggaagctattccaaatgacaatggaagagtaattatcgt 127  Q
    |||||||| ||||||||||||||||||||||||| ||||||||||| || ||||| ||||  ||||| |||||||| || ||||||| ||| ||||| ||    
37740446 tgcagtgggttttgcatgattggggggatgaagagtgcatccaaatcttaaagaactgtagagaagcaattccaaaagaaaatggaaaagttattattgt 37740347  T
128 ggaagcagtgattgaagaagg---aggaa---accacaagtataaagatgtagggttagtcttagatacggtgatgatg 200  Q
    |||||||||||||||||||||   |||||   || ||||||||||||| ||||||||| | ||||| | ||||||||||    
37740346 ggaagcagtgattgaagaaggagaaggaaaacacaacaagtataaagacgtagggttaatgttagacatggtgatgatg 37740268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University