View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18586_low_15 (Length: 362)
Name: NF18586_low_15
Description: NF18586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18586_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 106 - 347
Target Start/End: Complemental strand, 37654054 - 37653795
Alignment:
| Q |
106 |
cctgaaactttcttttcaataacaaaaaataattataatctatgctttatattgaatttatatacagggcaatattattgtcgccatttatacttggact |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37654054 |
cctgaaactttcttttcaataacaaaaaataattataatctatgctctatattgaatttatatacagggcaatattattgtcgccatttatacttggact |
37653955 |
T |
 |
| Q |
206 |
gacttttgcataatatattccgatggagtccaattcaaactccattaatccagtttcaaggttagtacctcggtttgctactatgcattag--------- |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37653954 |
gacttttgcataatatattccgatggagtccaattcaaactccattaatccagtttcaaggttagtacctcggtttgctactatgcattagcatttaact |
37653855 |
T |
 |
| Q |
297 |
---------caaagttcaaacaagttactaactagtgtttaaagacttggccaacatctt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37653854 |
tttatctttcaaagttcaaacaagttactaactagtgtttaaagacttggcaaacatctt |
37653795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University