View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18586_low_20 (Length: 317)
Name: NF18586_low_20
Description: NF18586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18586_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 4567962 - 4567659
Alignment:
| Q |
1 |
aatgactatttaggtctattaattgcttacagacacctcaaattatctaaaaagcaccaaacaataattatctaccgttttgaagcgaacaatagttaat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4567962 |
aatgactatttagggttattaattgcttacagacacctcaaattatctaaaaagcaccaaacaataattatctaccgttttgaagtgaacaatagttaat |
4567863 |
T |
 |
| Q |
101 |
tggcattctgcaaacggtaatagctatccgtgagcagttgctaggtgtctaaagagcaatcttcaaatattgaggagaaattaaacaactttcatcaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
4567862 |
tggcattctgcaaacggtaatagctatttgtgagcagttgctaggtgtctaaagagcaatcttcaaatattgagaagaaatttaacaactttcatcaact |
4567763 |
T |
 |
| Q |
201 |
tgcttttgcaatatgtctgaacatataaactttga----aatatatatgatataaatcttattgaatagggattgttcttctggtaaaaaagcaggactg |
296 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567762 |
tgcttttgcaatatgtctgaacatttaaactttgaaatgaatatatatgatataaatcttattgaatagggattgttcttctggtaaaaaagcaggactg |
4567663 |
T |
 |
| Q |
297 |
ctct |
300 |
Q |
| |
|
|||| |
|
|
| T |
4567662 |
ctct |
4567659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 130 - 167
Target Start/End: Original strand, 5934467 - 5934504
Alignment:
| Q |
130 |
gtgagcagttgctaggtgtctaaagagcaatcttcaaa |
167 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5934467 |
gtgagcaattgctagatgtctaaagagcaatcttcaaa |
5934504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University