View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18586_low_29 (Length: 230)
Name: NF18586_low_29
Description: NF18586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18586_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 4857917 - 4857716
Alignment:
| Q |
14 |
agaagaaaacaagcaaacatcagcataaataaacttagataaactaggtatgtaaacggcgccggagtagg-tactccccatccccgccgtccagaattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
4857917 |
agaagaaaacaagcaaacatcagcataaataaacttagataaactaggtatgtaaacggcgccggagtagggtactccccatccccgcagtccaaaattt |
4857818 |
T |
|
| Q |
113 |
tctccatccacgtctccattccctattttgaggagtactttcttcctgtttccgaccccgaaacccccgatttccacggtccttgcggggggattcataa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4857817 |
tctccatccacgtctccattccctattttgaggagtattttcttcctgtttccgaccccgaaacccccgatttccacggtccttgc-aggggattcataa |
4857719 |
T |
|
| Q |
213 |
aaa |
215 |
Q |
| |
|
||| |
|
|
| T |
4857718 |
aaa |
4857716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University