View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18587_high_17 (Length: 266)
Name: NF18587_high_17
Description: NF18587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18587_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 48691464 - 48691698
Alignment:
| Q |
12 |
agtgagatgaaggttaactattttgtgcaagaaaaaccggggtggtgttttccactaaaatatgacattattttctttaacttttaccnnnnnnnnnnnn |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48691464 |
agtgagatgaaggttaactattttgtgcaagaaaaaccggagtggtgttttccactaaaatatgacattattttctttaacttttacctatatat----- |
48691558 |
T |
|
| Q |
112 |
ntttctgtcnnnnnnnntaaacaata-----tatttttcaatattaagccgatagtatagatttgagcagagctccctccctcagtcacctaggtggtag |
206 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48691559 |
-tttctgtcaaaaaaaataaacaatacagtatatttttcaatattaagctgatagtatagatttgagcagagctccctccctcagttacctaggtggtag |
48691657 |
T |
|
| Q |
207 |
gtaatacctggactcggtaggtatatagataaccatcaacc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48691658 |
gtaatacctggactcggtaggtatatagacaaccatcaacc |
48691698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University