View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18587_low_30 (Length: 236)
Name: NF18587_low_30
Description: NF18587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18587_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 7081413 - 7081633
Alignment:
| Q |
1 |
cggatttctcctcgtcgggtcgcctgaagaattttccggcaagaataggatcaagctctgtcatgcaaatctccattgtgtattgttcataaggtatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7081413 |
cggatttctcctcgtcgggtcgcctgaagaattttccggcaagaataggatcaagctctgtcatgcaaatctccattgtgtattgttcataaggtatgtg |
7081512 |
T |
 |
| Q |
101 |
atgatgagggttttgggttgcagtgaaaacatgccatgaatgagatgaagattttgaaggcatgatggaagcttttctgaagcaaagatttgaagggata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7081513 |
atgatgagggttttgggttgcagtgaaaacatgccatgaatgagatgaagattttgaaggcatgatggaagcttttctgaagcaaagatttgaagggata |
7081612 |
T |
 |
| Q |
201 |
gtgttttctaagtaagaaact |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7081613 |
gtgttttctaagtaagaaact |
7081633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 119 - 211
Target Start/End: Complemental strand, 49020268 - 49020176
Alignment:
| Q |
119 |
tgcagtgaaaacatgccatgaatgagatgaagattttgaaggcatgatggaagcttttctgaagcaaagatttgaagggatagtgttttctaa |
211 |
Q |
| |
|
||||||||||||||||||||| || || || ||||| || |||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
49020268 |
tgcagtgaaaacatgccatgagtgtgaagaggatttagagggcatgatggaagcttttctatggcaaagatttgaagggatagtgtcttctaa |
49020176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University