View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18587_low_34 (Length: 215)
Name: NF18587_low_34
Description: NF18587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18587_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 40447510 - 40447705
Alignment:
| Q |
1 |
aaggagcaagaggactgagaaatcccgccggtaaaatagcaccacctttgtcattaacctttcttttcttagaaggactttccgccgtagctgtagcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40447510 |
aaggagcaagaggactgagaaatcccgccggtaaaatagcaccacctttgtcattaacctttcttttcttagaaggactttccgccgtagcggtagcaac |
40447609 |
T |
|
| Q |
101 |
aaccgaatctaaatcaacatcggaatcggaatcactgagttcgatgaccgagtcaggtatcggagcgggtgaatttgagtttcttctttgtcttct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447610 |
aaccgaatctaaatcaacatcggaatcggaatcactgagttcgatgaccgagtcaggtatcggagcgggtgaatttgagtttcttctttgtcttct |
40447705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University