View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_high_18 (Length: 348)
Name: NF18588_high_18
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 17 - 330
Target Start/End: Original strand, 10821753 - 10822065
Alignment:
| Q |
17 |
cagtgtatacctcaattgaaaaggttggtgttggttatatgaatcaaaggcaaagtggtaagggtgatggttcatggactgtttcagctatattgtggcc |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10821753 |
cagtgtatacctcaattgaaagggttggtgttggttatatgaatcaaaggcaaagtggcaagggtgatggttcatggactgtttcagctatattgtggcc |
10821852 |
T |
 |
| Q |
117 |
tgaattagtagatgctttgaaggatgatccaatttttcagcccatgactgcttctcatctacagctttagtacaatgcattcgtagcatcaacacttcga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10821853 |
tgaattagtagatgctttgaaggatgatccaatttttcagcccatgactgcttcttatctacagctttagtacaatgcatatgtagcatcaacacttcga |
10821952 |
T |
 |
| Q |
217 |
atcgaatgtgtgtccgatacatgtctttacattcaattattacgtattctcaagttattgcaagttgttgttgttaacgtgttagtgtcgtgttcagtac |
316 |
Q |
| |
|
|| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| ||| |
|
|
| T |
10821953 |
attgaaggtgtgtccgatacatgtgtttacattcaattattacgtattctcaagttattgcaag-tgttgttattaacgtgtcagtgtcgtgttctatac |
10822051 |
T |
 |
| Q |
317 |
ttgtggctgtatca |
330 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10822052 |
ttgtggctgtatca |
10822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University