View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18588_high_35 (Length: 261)
Name: NF18588_high_35
Description: NF18588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18588_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 7752475 - 7752710
Alignment:
| Q |
16 |
caaaaatgtcctacttgggattaaatctcaattcaacaatgcctcagtcttcacaacctgggatcctatcactgactgctgtaaaaattggtcaggcata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752475 |
caaaaatgtcctacttgggattaaatctcaattcaacaatgcctcagtcttcacaacatgggatcctatcactgactgctgtaaaaattggtcaggcata |
7752574 |
T |
 |
| Q |
116 |
gaatgcaattcaaatggccgtgtgaccatgcttgcagttagtgacaccaatgacgtcgttggcgagatcccaacatcggtagtaaaccttccgttcctcc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7752575 |
gaatgcaattcaaatggccgtgtgaccatgcttgcagttagtgacaccaatgacgtcattggcgagatcccaacctcggtagtaaaccttccgttcctcc |
7752674 |
T |
 |
| Q |
216 |
aatttttcacattcgctgtctttcccggtgtctctg |
251 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
7752675 |
aattttttacatttgctgtctttcccggtgtctctg |
7752710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University